v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5S ribosomal RNA from Mus musculus (PDB 7LS1, chain B2) secondary structure diagram

5S ribosomal RNA from Mus musculus (PDB 7LS1, chain B2) URS00000F9D45_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Oryctolagus cuniculus 5S ribosomal RNA from Oryctolagus cuniculus (PDB 4D67, chain 4)
  2. Cavia porcellus 5S ribosomal RNA (LOC100379618)
  3. Homo sapiens (human) RNA, 5S ribosomal 1 (RNA5S1-8, RNA5S10-17)
  4. Macaca fascicularis 5S ribosomal RNA
  5. Mesocricetus auratus rRNA
  6. Rattus norvegicus RNA (121-MER) from Rattus norvegicus (PDB 7QGG, chain E)
  7. Tursiops truncatus 5S ribosomal RNA
 2D structure Publications