Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-196a-5p URS00000DA6A7_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, ENA, GeneCards, MalaCards, LncBase, MirGeneDB, TarBase, RefSeq). Described in 98 papers. Homo sapiens (human) hsa-miR-196a-5p sequence is a product of MIR196A2, hsa-miR-196a, miR-196a, miR-196a-5p, hsa-miR-196a-5p, miR-196, MIR196A1 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 16A, 182-FIP, 2'-PDE, 3635, 5'OY11.1, 6.8PL, 6A3-5, 82-FIP.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGGUAGUUUCAUGUUGUUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-196-P2_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-196-P3_5p (mature (guide))
    3. Ateles geoffroyi age-miR-196
    4. Bos taurus (cattle) bta-miR-196a
    5. Callorhinchus milii miR-196b
    6. Canis lupus familiaris cfa-miR-196a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-196a-5p
    8. Chiloscyllium plagiosum microRNA cpl-miR-196a
    9. Chrysemys picta bellii Cpi-Mir-196-P1_5p (mature (guide))
    10. Chrysemys picta cpi-miR-196-5p
    11. Columba livia cli-miR-196-5p
    12. Cricetulus griseus cgr-miR-196a-5p
    13. Cyprinus carpio (common carp) ccr-miR-196a
    14. Danio rerio dre-miR-196a-5p
    15. Daubentonia madagascariensis dma-miR-196
    16. Eptatretus burgeri (inshore hagfish) miR-196IV
    17. Equus caballus eca-miR-196a
    18. Gadus morhua (Atlantic cod) gmo-miR-196a-5p
    19. Gallus gallus (chicken) Gga-Mir-196-P3f_5p (mature (guide))
    20. Gorilla gorilla microRNA mir-196-2
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-196a
    22. Lagothrix lagotricha lla-miR-196
    23. Lethenteron camtschaticum miR-196
    24. Macaca mulatta Mml-Mir-196-P1_5p (mature (guide))
    25. Maylandia zebra (zebra mbuna) mze-miR-196a
    26. Mus musculus mmu-miR-196a-5p
    27. Neolamprologus brichardi nbr-miR-196a
    28. Ophiophagus hannah oha-miR-196b-5p
    29. Oreochromis niloticus oni-miR-196a
    30. Ornithorhynchus anatinus oan-miR-196a-5p
    31. Oryctolagus cuniculus ocu-miR-196a-5p
    32. Otolemur garnettii oga-miR-196a
    33. Pan paniscus (pygmy chimpanzee) ppa-miR-196
    34. Pan troglodytes ptr-miR-196a
    35. Papio hamadryas pha-miR-196a
    36. Petromyzon marinus (sea lamprey) pma-miR-196a-5p
    37. Pongo pygmaeus ppy-miR-196-2
    38. Pundamilia nyererei pny-miR-196a
    39. Rattus norvegicus (Norway rat) rno-miR-196a-5p
    40. Salmo salar ssa-miR-196a-5p
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-196-P3_5p (mature (guide))
    42. Sus scrofa (pig) ssc-miR-196a
    43. Taeniopygia guttata Tgu-Mir-196-P3_5p (mature (guide))
    44. Takifugu rubripes fru-miR-196a
    45. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-196a
    46. Tor tambroides miR-196a-5p
    47. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-196-P2_5p (mature (guide))