Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-196a URS00000DA6A7_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-196a: Ssc-mir-196a is a microRNA that has been identified as one of the differentially expressed miRNAs in various studies. In one study, it was found to be up-regulated along with other miRNAs such as ssc-miR-582-5p, ssc-miR-150, ssc-miR-155-5p, and ssc-miR-331-5p [PMC9778086]. Another study showed that ssc-mir-196a and ssc-miR-451 exhibited a pattern of increased expression at 1W and decreased expression at 2W in piglet development [PMC8367414]. Ssc-mir-196a was further investigated in the same study as it represented pattern 1 among the differentially expressed miRNAs [PMC8367414]. Additionally, it was found to be a shared node in both lncRNA–miRNA–mRNA co-regulatory networks and circRNA–miRNA–mRNA co-regulatory networks [PMC9603960]. Ssc-mir-196a has also been reported to be related to lipid metabolism along with other miRNAs such as ssc-miR-141, ssc-miR192, and sscmiR486 [PMC9603960]. In another study on colorectal neoplasia, elevated expression of sscmir196a was observed in more advanced samples compared to early-stage samples [PMC5707088]. The higher expression of mir196a has also been associated with cell growth promotion, migration, and invasion of colorectal cancer cells [PMC5707088]. These findings highlight the importance of mir196a in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCAUGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-196-P3_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-196-P1_5p (mature (guide))
  3. Ateles geoffroyi age-miR-196
  4. Bos taurus bta-miR-196a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-196-P4_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-196a
  7. Cavia porcellus cpo-miR-196a-5p
  8. Chiloscyllium plagiosum microRNA cpl-miR-196a
  9. Chrysemys picta bellii Cpi-Mir-196-P3_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-196-5p
  11. Columba livia (rock pigeon) cli-miR-196-5p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-196a-5p
  13. Cyprinus carpio ccr-miR-196a
  14. Danio rerio (zebrafish) dre-miR-196a-5p
  15. Daubentonia madagascariensis dma-miR-196
  16. Eptatretus burgeri Ebu-Mir-196-P5_5p (mature (guide))
  17. Equus caballus eca-miR-196a
  18. Gadus morhua gmo-miR-196a-5p
  19. Gallus gallus Gga-Mir-196-P3_5p (mature (guide))
  20. Gekko japonicus Gja-Mir-196-P1_5p (mature (guide))
  21. Gorilla gorilla microRNA mir-196-2
  22. Haplochromis burtoni abu-miR-196a
  23. Homo sapiens (human) hsa-miR-196a-5p
  24. Lagothrix lagotricha lla-miR-196
  25. Latimeria chalumnae (coelacanth) Lch-Mir-196-P3_5p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-196-P3_5p (mature (guide))
  27. Lethenteron camtschaticum (Arctic lamprey) miR-196
  28. Macaca mulatta (Rhesus monkey) Mml-Mir-196-P3_5p (mature (guide))
  29. Maylandia zebra (zebra mbuna) mze-miR-196a
  30. Microcaecilia unicolor Mun-Mir-196-P1_5p (mature (guide))
  31. Monopterus albus (swamp eel) Mal-Mir-196-P4a_5p (mature (guide))
  32. Mus musculus mmu-miR-196a-5p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-196a
  34. Ophiophagus hannah oha-miR-196b-5p
  35. Oreochromis niloticus (Nile tilapia) oni-miR-196a
  36. Ornithorhynchus anatinus (platypus) oan-miR-196a-5p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-196a-5p
  38. Otolemur garnettii (small-eared galago) oga-miR-196a
  39. Pan paniscus (pygmy chimpanzee) ppa-miR-196
  40. Pan troglodytes ptr-miR-196a
  41. Papio hamadryas (hamadryas baboon) pha-miR-196a
  42. Petromyzon marinus pma-miR-196a-5p
  43. Pongo pygmaeus ppy-miR-196-2
  44. Pundamilia nyererei pny-miR-196a
  45. Rattus norvegicus rno-miR-196a-5p
  46. Salmo salar (Atlantic salmon) ssa-miR-196a-5p
  47. Scyliorhinus torazame Sto-Mir-196-P3_5p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-196-P1_5p (mature (guide))
  49. Taeniopygia guttata (zebra finch) Tgu-Mir-196-P1_5p (mature (guide))
  50. Takifugu rubripes fru-miR-196a
  51. Tetraodon nigroviridis tni-miR-196a
  52. Tor tambroides (Thai mahseer) miR-196a-5p
  53. Xenopus laevis Xla-Mir-196-P4c-v1_5p (mature (guide))
  54. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-196-P4_5p (mature (guide))
Publications