Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daubentonia madagascariensis (aye-aye) dma-miR-196 URS00000DA6A7_31869

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCAUGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-196-P3_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-196-P1_5p (mature (guide))
  3. Ateles geoffroyi age-miR-196
  4. Bos taurus bta-miR-196a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-196-P4_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-196a
  7. Cavia porcellus cpo-miR-196a-5p
  8. Chiloscyllium plagiosum microRNA cpl-miR-196a
  9. Chrysemys picta bellii Cpi-Mir-196-P3_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-196-5p
  11. Columba livia (rock pigeon) cli-miR-196-5p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-196a-5p
  13. Cyprinus carpio ccr-miR-196a
  14. Danio rerio (zebrafish) dre-miR-196a-5p
  15. Eptatretus burgeri Ebu-Mir-196-P5_5p (mature (guide))
  16. Equus caballus eca-miR-196a
  17. Gadus morhua gmo-miR-196a-5p
  18. Gallus gallus Gga-Mir-196-P3_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-196-P1_5p (mature (guide))
  20. Gorilla gorilla microRNA mir-196-2
  21. Haplochromis burtoni abu-miR-196a
  22. Homo sapiens (human) hsa-miR-196a-5p
  23. Lagothrix lagotricha lla-miR-196
  24. Latimeria chalumnae (coelacanth) Lch-Mir-196-P3_5p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-196-P3_5p (mature (guide))
  26. Lethenteron camtschaticum (Arctic lamprey) miR-196
  27. Macaca mulatta (Rhesus monkey) Mml-Mir-196-P3_5p (mature (guide))
  28. Maylandia zebra (zebra mbuna) mze-miR-196a
  29. Microcaecilia unicolor Mun-Mir-196-P1_5p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-196-P4a_5p (mature (guide))
  31. Mus musculus mmu-miR-196a-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-196a
  33. Ophiophagus hannah oha-miR-196b-5p
  34. Oreochromis niloticus (Nile tilapia) oni-miR-196a
  35. Ornithorhynchus anatinus (platypus) oan-miR-196a-5p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-196a-5p
  37. Otolemur garnettii (small-eared galago) oga-miR-196a
  38. Pan paniscus (pygmy chimpanzee) ppa-miR-196
  39. Pan troglodytes ptr-miR-196a
  40. Papio hamadryas (hamadryas baboon) pha-miR-196a
  41. Petromyzon marinus pma-miR-196a-5p
  42. Pongo pygmaeus ppy-miR-196-2
  43. Pundamilia nyererei pny-miR-196a
  44. Rattus norvegicus rno-miR-196a-5p
  45. Salmo salar (Atlantic salmon) ssa-miR-196a-5p
  46. Scyliorhinus torazame Sto-Mir-196-P3_5p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-196-P1_5p (mature (guide))
  48. Sus scrofa ssc-miR-196a
  49. Taeniopygia guttata (zebra finch) Tgu-Mir-196-P1_5p (mature (guide))
  50. Takifugu rubripes fru-miR-196a
  51. Tetraodon nigroviridis tni-miR-196a
  52. Tor tambroides (Thai mahseer) miR-196a-5p
  53. Xenopus laevis Xla-Mir-196-P4c-v1_5p (mature (guide))
  54. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-196-P4_5p (mature (guide))