v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-196 (MIR196-2) URS00000D9842_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGGUAGUUUCAUGUUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Alligator mississippiensis (American alligator) ami-miR-196-5p
  2. Anolis carolinensis aca-miR-196a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-196a
  4. Callorhinchus milii (elephant shark) eshark_mir-196_3
  5. Capra hircus (goat) chi-miR-196a
  6. Gallus gallus gga-miR-196-5p
  7. Gorilla gorilla ggo-miR-196
  8. Homo sapiens (human) microRNA miR-196
  9. Macaca mulatta (Rhesus monkey) mml-miR-196a-5p
  10. Mus musculus Mus_musculus piRNA piR-mmu-8195632
  11. Oryzias latipes ola-miR-196a
  12. Pongo pygmaeus ppy-miR-196
  13. Xenopus tropicalis (tropical clawed frog) xtr-miR-196a
 Publications