Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8195632 URS00000D9842_10090

• 21 nucleotides
• 2 databases (ENA, PirBase)
• Found in 13 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGGUAGUUUCAUGUUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Alligator mississippiensis (American alligator) ami-miR-196-5p
2. Anolis carolinensis aca-miR-196a
3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-196a
4. Callorhinchus milii (elephant shark) eshark_mir-196_3
5. Capra hircus (goat) chi-miR-196a
6. Gallus gallus gga-miR-196-5p
7. Gorilla gorilla gorilla ggo-miR-196 (MIR196-2)
8. Gorilla gorilla ggo-miR-196
9. Homo sapiens (human) microRNA miR-196
10. Macaca mulatta (Rhesus monkey) mml-miR-196a-5p
11. Oryzias latipes ola-miR-196a
12. Pongo pygmaeus ppy-miR-196
13. Xenopus tropicalis (tropical clawed frog) xtr-miR-196a

Download

• FASTA
• JSON