Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryzias latipes (Japanese medaka) ola-miR-196a URS00000D9842_8090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCAUGUUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Alligator mississippiensis (American alligator) ami-miR-196-5p
  2. Anolis carolinensis aca-miR-196a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-196a
  4. Callorhinchus milii (elephant shark) eshark_mir-196_3
  5. Capra hircus (goat) chi-miR-196a
  6. Gallus gallus gga-miR-196-5p
  7. Gorilla gorilla gorilla ggo-miR-196 (MIR196-2)
  8. Gorilla gorilla ggo-miR-196
  9. Homo sapiens (human) microRNA miR-196
  10. Macaca mulatta (Rhesus monkey) mml-miR-196a-5p
  11. Mus musculus Mus_musculus piRNA piR-mmu-8195632
  12. Pongo pygmaeus ppy-miR-196
  13. Xenopus tropicalis (tropical clawed frog) xtr-miR-196a
Publications