Xenopus tropicalis (tropical clawed frog) xtr-miR-196a URS00000D9842_8364

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 13 other species
• 79 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGGUAGUUUCAUGUUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Alligator mississippiensis (American alligator) ami-miR-196-5p
2. Anolis carolinensis aca-miR-196a
3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-196a
4. Callorhinchus milii (elephant shark) eshark_mir-196_3
5. Capra hircus (goat) chi-miR-196a
6. Gallus gallus gga-miR-196-5p
7. Gorilla gorilla gorilla ggo-miR-196 (MIR196-2)
8. Gorilla gorilla ggo-miR-196
9. Homo sapiens (human) microRNA miR-196
10. Macaca mulatta (Rhesus monkey) mml-miR-196a-5p
11. Mus musculus Mus_musculus piRNA piR-mmu-8195632
12. Oryzias latipes ola-miR-196a
13. Pongo pygmaeus ppy-miR-196

Publications Download

• FASTA
• JSON