Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-499-5p URS00000C7662_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (TarBase, miRBase, PirBase, PSICQUIC, LncBase, RefSeq, ENA). Described in 27 papers. Mus musculus (house mouse) mmu-miR-499-5p sequence is a product of mmu-miR-499-5p, miR-499-5p, miR-499, Mir499, mmu-miR-499 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610011E17Rik, 0610011N22Rik, 0610012A05Rik, 0610025M10Rik, 0610039A15Rik, 0610039C21Rik, 0610041D24Rik, 0610042I06Rik, 0610043A03Rik.

Interactions 9

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-499-5p interacts with:

Interaction id Participant Synonyms
URS00000C7662_10090-0 O35295 O35295
URS00000C7662_10090-5 O35295 O35295
URS00000C7662_10090-6 O70494 O70494
URS00000C7662_10090-1 O70494 O70494
URS00000C7662_10090-2 P40645 P40645
URS00000C7662_10090-7 P40645 P40645
URS00000C7662_10090-3 P58391 P58391
URS00000C7662_10090-8 Q8CC27 Q8CC27
URS00000C7662_10090-4 Q8CC27 Q8CC27

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAAGACUUGCAGUGAUGUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Alligator mississippiensis ami-miR-499-5p
    2. Bos taurus (cattle) bta-miR-499
    3. Callithrix jacchus cja-miR-499a
    4. Canis lupus familiaris cfa-miR-499
    5. Capra hircus chi-miR-499-5p
    6. Equus caballus (horse) eca-miR-499-5p
    7. Homo sapiens hsa-miR-499a-5p
    8. Ictalurus punctatus (channel catfish) ipu-miR-499
    9. Macaca mulatta mml-miR-499-5p
    10. Monodelphis domestica mdo-miR-499-5p
    11. Pongo pygmaeus ppy-miR-499-5p
    12. Pteropus alecto pal-miR-499a-5p
    13. Rattus norvegicus rno-miR-499-5p
    14. Sus scrofa ssc-miR-499-5p
    15. Tupaia chinensis tch-miR-499a-5p
    16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1658060