Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-223-3p URS00000B7E30_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (ENA, LncBase, miRBase, RefSeq, TarBase, PirBase, PSICQUIC). Described in 55 papers. Mus musculus (house mouse) mmu-miR-223-3p sequence is a product of miR-223, miR-223-3p, Mir223, mmu-miR-223, mmu-miR-223-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610005M07Rik, 0610006H10Rik, 0610006J14Rik, 0610006N12Rik, 0610008A10Rik, 0610008L17Rik, 0610009H20Rik, 0610009J22Rik, 0610009K11Rik, 0610010C24Rik.

Interactions 10

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-223-3p interacts with:

Interaction id Participant Synonyms
URS00000B7E30_10090-0 P08505 P08505
URS00000B7E30_10090-5 P08505 P08505
URS00000B7E30_10090-1 P10855 P10855
URS00000B7E30_10090-6 P10855 P10855
URS00000B7E30_10090-2 P10889 P10889
URS00000B7E30_10090-7 P19875 P19875
URS00000B7E30_10090-4 P28033 P28033
URS00000B7E30_10090-8 P28033 P28033
URS00000B7E30_10090-9 Q8C0J2 Q8C0J2
URS00000B7E30_10090-3 Q8C0J2 Q8C0J2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUCAGUUUGUCAAAUACCCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Bos taurus (cattle) bta-miR-223
    2. Callithrix jacchus cja-miR-223
    3. Capra hircus chi-miR-223-3p
    4. Chrysemys picta (Painted turtle) cpi-miR-223-3p
    5. Columba livia (rock pigeon) cli-miR-223-3p
    6. Equus caballus (horse) eca-miR-223
    7. Gadus morhua gmo-miR-223a-3p
    8. Homo sapiens hsa-miR-223-3p
    9. Tursiops truncatus miR-223