Tursiops truncatus (common bottlenose dolphin) miR-223

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tursiops truncatus (common bottlenose dolphin) miR-223 URS00000B7E30_9739

22 nucleotides
1 database (ENA)
Found in 9 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGUCAGUUUGUCAAAUACCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Bos taurus (cattle) bta-miR-223
Callithrix jacchus cja-miR-223
Capra hircus (goat) chi-miR-223-3p
Chrysemys picta (Painted turtle) cpi-miR-223-3p
Columba livia (rock pigeon) cli-miR-223-3p
Equus caballus (horse) eca-miR-223
Gadus morhua gmo-miR-223a-3p
Homo sapiens hsa-miR-223-3p
Mus musculus mmu-miR-223-3p