Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-223 URS00000B7E30_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-223: Bta-mir-223 is a microRNA that has been identified as a possible biomarker for the early diagnosis of mastitis in cows [PMC9598662]. In a study that established the miRNA expression profile of bovine milk exosomes in response to S. aureus infection, bta-mir-223 was found to be one of the miRNAs that showed differential expression [PMC9598662]. The study also identified bta-miR-142-5p as another potential biomarker for mastitis diagnosis [PMC9598662]. Further research has shown that silencing the RHOB gene, which is involved in regulating inflammatory responses, inhibits the release of inflammatory factors in bovine mammary epithelial cells (bMECs) [PMC9563457]. This finding is consistent with the results observed in a group where bta-mir-223 was artificially increased (mimic group), which also showed attenuation of the inflammatory response in bMECs [PMC9563457]. These findings suggest that bta-mir-223 may play a role in regulating inflammatory responses during mastitis. The differential expression of this microRNA could potentially be used as an early diagnostic marker for mastitis, allowing for timely intervention and treatment. However, further research is needed to fully understand the mechanisms and potential clinical applications of bta-mir-223 in mastitis diagnosis and treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCAGUUUGUCAAAUACCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Callithrix jacchus cja-miR-223
  2. Capra hircus (goat) chi-miR-223-3p
  3. Chrysemys picta (Painted turtle) cpi-miR-223-3p
  4. Columba livia (rock pigeon) cli-miR-223-3p
  5. Equus caballus (horse) eca-miR-223
  6. Gadus morhua gmo-miR-223a-3p
  7. Homo sapiens hsa-miR-223-3p
  8. Mus musculus mmu-miR-223-3p
  9. Tursiops truncatus miR-223
Publications