Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-223 URS00000B7E30_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-223: Eca-mir-223 is a microRNA that has been found to be expressed at higher levels in old diseased mares compared to young diseased mares and healthy control mares [PMC8227551]. It is one of several microRNAs, including eca-miR-155, eca-miR-200a, and eca-miR-205, that have been shown to target inflammatory immune response genes [PMC8227551]. This study is the first to investigate the expression profile of eca-mir-223 in mares with endometritis [PMC8227551]. The study aimed to measure the expression levels of eca-mir-223 and other microRNAs, as well as the concentrations of IL-6, PGF2α, and PGE2 in serum samples from young and old mares with healthy and abnormal uterine status [PMC8227551]. The results showed higher expression levels of eca-mir-223 in old diseased mares compared to young diseased mares and control mares [PMC8227551]. The over-expression of eca-mir-223 was observed in both young and old diseased mares compared to control healthy mares [PMC8227551]. Eca-mir-223 was found only in microvesicles (MVs) according to RNA-seq data, while other microRNAs such as eca-miR-26 and eca-miR-146a were present in both MVs and cells [PMC6434479]. Real-time PCR validated the expression of eca-miR26, ecam-MIR146a, and ECA-MIR223 in MVs compared to cells [PMC6434479]. These findings suggest that ECA-MIR223 could be a potential target for further research on endometritis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCAGUUUGUCAAAUACCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus (cattle) bta-miR-223
  2. Callithrix jacchus cja-miR-223
  3. Capra hircus (goat) chi-miR-223-3p
  4. Chrysemys picta (Painted turtle) cpi-miR-223-3p
  5. Columba livia (rock pigeon) cli-miR-223-3p
  6. Gadus morhua gmo-miR-223a-3p
  7. Homo sapiens hsa-miR-223-3p
  8. Mus musculus mmu-miR-223-3p
  9. Tursiops truncatus miR-223
Publications