Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-19a URS000006FDD4_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-19a: Ssc-mir-19a is a pig-encoded DE miRNA that has been shown to target pre-miRNA ssc-mir-21 [PMC7329775]. It is differentially expressed and plays a role in the urea cycle [PMC5043173]. Ssc-mir-19a has been found to target TNFα, IL-12α, IL-20, and other genes involved in immune response [PMC4778948]. It is one of the five overlapping DEmiRNAs used for gene ontology and pathway analyses in the DAVID software to understand miRNA regulatory function in different pig breeds [PMC4536519]. Ssc-mir-19a has also been found to target HSPA1A and is expressed in castrated male pigs [PMC3490867] [PMC3901342]. It has been shown to regulate PRRSV infection by targeting key receptors or directly targeting the virus genome [PMC10000162]. Its expression has been found to increase in response to treatment in a qRT-PCR study [PMC10000162]. Additionally, ssc-mir-19a has been predicted to target NRF2 and GCLC genes involved in oxidative stress response and glutathione synthesis, respectively [PMC7426424].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis Ami-Mir-19-P1a_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  4. Bos taurus bta-miR-19a
  5. Callithrix jacchus cja-miR-19a
  6. Callorhinchus milii (elephant shark) Cmi-Mir-19-P1a-v1_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-19a
  8. Capra hircus (goat) chi-miR-19a
  9. Cavia porcellus cpo-miR-19a-3p
  10. Cervus elaphus cel-miR-19a
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  12. Columba livia (rock pigeon) cli-miR-19a-3p
  13. Cricetulus griseus cgr-miR-19a
  14. Danio rerio dre-miR-19a-3p
  15. Dasypus novemcinctus dno-miR-19a-3p
  16. Echinops telfairi Ete-Mir-19-P1a_3p (mature (guide))
  17. Equus caballus eca-miR-19a
  18. Gadus morhua gmo-miR-19a-3p
  19. Gallus gallus (chicken) gga-miR-19a-3p
  20. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  22. Gorilla gorilla ggo-miR-19a
  23. Homo sapiens hsa-miR-19a-3p
  24. Lagothrix lagotricha lla-miR-19a
  25. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  26. Lemur catta (Ring-tailed lemur) lca-miR-19a
  27. Macaca mulatta mml-miR-19a-3p
  28. Macaca nemestrina mne-miR-19a
  29. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  30. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  31. Monopterus albus (swamp eel) Mal-Mir-19-P1a2_3p (mature (guide))
  32. Mus musculus mmu-miR-19a-3p
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  34. Ophiophagus hannah oha-miR-19a-3p
  35. Ornithorhynchus anatinus oan-miR-19a-3p
  36. Oryctolagus cuniculus ocu-miR-19a-3p
  37. Ovis aries (sheep) miscellaneous RNA
  38. Pan paniscus ppa-miR-19a
  39. Pan troglodytes ptr-miR-19a
  40. Pongo pygmaeus ppy-miR-19a
  41. Python bivittatus (Burmese python) pbv-miR-19a-3p
  42. Rattus norvegicus (Norway rat) rno-miR-19a-3p
  43. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  45. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  46. Sphenodon punctatus Spt-Mir-19-P1a_3p (mature (guide))
  47. Takifugu rubripes fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides (Thai mahseer) miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a
Publications