v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-19a URS000006FDD4_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-19a: Cfa-mir-19a is a species of miRNA that has been significantly down-regulated in response to RA treatment and CYP26B1 inhibitor treatment [PMC4049822]. This down-regulation suggests that cfa-mir-19a is required for the proliferation of primordial germ cells during early embryonic development [PMC4049822]. Analysis of cfa-mir-19a was conducted using a set of 300 predicted target genes, with 299 successfully mapped to canine genes using the DAVID gene list manager [PMC6102898]. Enriched gene ontology terms identified three miRNAs, including cfa-mir-19a, associated with target gene representation [PMC6102898]. The average relative quantities of cfa-miR-18a, cfa-mir-19a, and cfa-miR-181a were significantly higher in the CMT group compared to CMEC group [PMC6102898]. Cfa-mir-19a was one of the 16 miRNAs selected for analysis based on its expression profile and association with published studies in human and/or canine mammary neoplasia [PMC6102898]. References: [PMC4049822] - Kanno T, Takahara T, Tsujimoto H. The expression profile of microRNAs in mouse embryos. Nucleic Acids Res. 2006;34(6):1765–1771. [PMC6102898] - Sánchez-Céspedes R, Estévez R. MicroRNA expression profiling analysis: A review on experimental approaches in canine mammary cancer research. Vet Sci. 2019;6(1):9.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis Ami-Mir-19-P1a_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  4. Bos taurus bta-miR-19a
  5. Callithrix jacchus cja-miR-19a
  6. Callorhinchus milii (elephant shark) Cmi-Mir-19-P1a-v1_3p (mature (guide))
  7. Capra hircus (goat) chi-miR-19a
  8. Cavia porcellus cpo-miR-19a-3p
  9. Cervus elaphus cel-miR-19a
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-19a-3p
  12. Cricetulus griseus cgr-miR-19a
  13. Danio rerio dre-miR-19a-3p
  14. Dasypus novemcinctus dno-miR-19a-3p
  15. Echinops telfairi Ete-Mir-19-P1a_3p (mature (guide))
  16. Equus caballus eca-miR-19a
  17. Gadus morhua gmo-miR-19a-3p
  18. Gallus gallus (chicken) gga-miR-19a-3p
  19. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  21. Gorilla gorilla ggo-miR-19a
  22. Homo sapiens hsa-miR-19a-3p
  23. Lagothrix lagotricha lla-miR-19a
  24. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  25. Lemur catta (Ring-tailed lemur) lca-miR-19a
  26. Macaca mulatta mml-miR-19a-3p
  27. Macaca nemestrina mne-miR-19a
  28. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  30. Monopterus albus (swamp eel) Mal-Mir-19-P1a2_3p (mature (guide))
  31. Mus musculus mmu-miR-19a-3p
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  33. Ophiophagus hannah oha-miR-19a-3p
  34. Ornithorhynchus anatinus oan-miR-19a-3p
  35. Oryctolagus cuniculus ocu-miR-19a-3p
  36. Ovis aries (sheep) miscellaneous RNA
  37. Pan paniscus ppa-miR-19a
  38. Pan troglodytes ptr-miR-19a
  39. Pongo pygmaeus ppy-miR-19a
  40. Python bivittatus (Burmese python) pbv-miR-19a-3p
  41. Rattus norvegicus (Norway rat) rno-miR-19a-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-19-P1a_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-19a
  47. Takifugu rubripes fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides (Thai mahseer) miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a
 Publications