Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30a-3p URS0000065D58_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (PSICQUIC, IntAct, LncBase, TarBase, RefSeq, miRBase, ENA, MalaCards, MirGeneDB, GeneCards). Described in 74 papers. Homo sapiens (human) hsa-miR-30a-3p sequence is a product of hsa-miR-30a, hsa-miR-30a-3p, miR-30a, miR-30a-3p, miR-30, MIR30A genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3-zeta, 182-FIP, 1A1-3B, 2610509L04Rik, 2H9, 30K, 3D3, 3G2, 4E-T, 7A5.

Interactions 7

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-30a-3p interacts with:

Interaction id Participant Synonyms
EBI-25436282 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
URS0000065D58_9606-0 P17302 P17302
URS0000065D58_9606-3 P17302 P17302
URS0000065D58_9606-4 P51608 P51608
URS0000065D58_9606-1 P51608 P51608
URS0000065D58_9606-2 Q92793 Q92793
URS0000065D58_9606-5 Q92793 Q92793

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUCAGUCGGAUGUUUGCAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Alligator mississippiensis ami-miR-30a-3p
    2. Anolis carolinensis aca-miR-30a-3p
    3. Bos taurus (cattle) Bta-Mir-30-P1a_3p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-30-P1a_3p* (star (passenger))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-30a-3p
    6. Chrysemys picta bellii Cpi-Mir-30-P1a_3p* (star (passenger))
    7. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
    8. Columba livia (rock pigeon) cli-miR-30a-3p
    9. Cricetulus griseus cgr-miR-30a-3p
    10. Danio rerio (zebrafish) dre-miR-30e-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-3p
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P1a_3p* (star (passenger))
    13. Gallus gallus (chicken) gga-miR-30a-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
    15. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
    16. Ictalurus punctatus (channel catfish) ipu-miR-30e
    17. Macaca mulatta mml-miR-30a-3p
    18. Monodelphis domestica Mdo-Mir-30-P1a_3p* (star (passenger))
    19. Mus musculus (house mouse) mmu-miR-30a-3p
    20. Ophiophagus hannah oha-miR-30a-3p
    21. Ornithorhynchus anatinus oan-miR-30a-3p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-30a-3p
    23. Pan paniscus ppa-miR-30a-3p
    24. Pan troglodytes (chimpanzee) ptr-miR-30a-3p
    25. Pongo pygmaeus ppy-miR-30a-3p
    26. Python bivittatus pbv-miR-30a-3p
    27. Rattus norvegicus rno-miR-30a-3p
    28. Salmo salar (Atlantic salmon) ssa-miR-30d-3p
    29. Sarcophilus harrisii Sha-Mir-30-P1a_3p* (star (passenger))
    30. Sus scrofa ssc-miR-30a-3p
    31. Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1a_3p* (star (passenger))
    32. Tor tambroides miR-30e-3p
    33. Tursiops truncatus miR-30a-3p