Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30a-3p URS0000065D58_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (ENA, TarBase, PirBase, LncBase, miRBase, RefSeq, MirGeneDB). Described in 33 papers. Mus musculus (house mouse) mmu-miR-30a-3p sequence is a product of miR-30a, miR-30a-3p, Mir30a, miR-30, mmu-miR-30a, 30a-a, 30a-as, miR-30a-as, mmu-miR-30a-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1110004P15Rik, 1300007E16Rik, 1700047G05Rik, 2010302A17Rik, 2310047C17Rik, 2410081F06Rik, 2600001O03Rik, 2610203K23Rik, 2700033A15Rik, 3010002K18Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUCAGUCGGAUGUUUGCAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 32 other species

    1. Alligator mississippiensis (American alligator) ami-miR-30a-3p
    2. Anolis carolinensis (green anole) aca-miR-30a-3p
    3. Bos taurus (cattle) Bta-Mir-30-P1a_3p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-30-P1a_3p* (star (passenger))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-30a-3p
    6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P1a_3p* (star (passenger))
    7. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
    8. Columba livia cli-miR-30e-3p
    9. Cricetulus griseus cgr-miR-30a-3p
    10. Danio rerio (zebrafish) dre-miR-30e-3p
    11. Dasypus novemcinctus dno-miR-30a-3p
    12. Echinops telfairi Ete-Mir-30-P1a_3p* (star (passenger))
    13. Gallus gallus (chicken) gga-miR-30a-3p
    14. Gorilla gorilla ggo-miR-30a-3p
    15. Haplochromis burtoni abu-miR-30a-3p
    16. Homo sapiens (human) hsa-miR-30a-3p
    17. Ictalurus punctatus ipu-miR-30e
    18. Macaca mulatta mml-miR-30a-3p
    19. Monodelphis domestica Mdo-Mir-30-P1a_3p* (star (passenger))
    20. Ophiophagus hannah oha-miR-30a-3p
    21. Ornithorhynchus anatinus oan-miR-30a-3p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-30a-3p
    23. Pan paniscus ppa-miR-30a-3p
    24. Pan troglodytes (chimpanzee) ptr-miR-30a-3p
    25. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
    26. Python bivittatus pbv-miR-30a-3p
    27. Rattus norvegicus (Norway rat) rno-miR-30a-3p
    28. Salmo salar ssa-miR-30c-3p
    29. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P1a_3p* (star (passenger))
    30. Sus scrofa ssc-miR-30a-3p
    31. Taeniopygia guttata Tgu-Mir-30-P1a_3p* (star (passenger))
    32. Tor tambroides (Thai mahseer) miR-30e-3p
    33. Tursiops truncatus (common bottlenose dolphin) miR-30a-3p