Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30a-3p URS0000065D58_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-30a: Mmu-mir-30a is a down-regulated miRNA after high-fat diet (HFD)-induced obesity [PMC3319598]. It has been shown to be downregulated in plasma and aorta tissue samples [PMC4346489]. Mmu-mir-30a has been found to target BDNF 3'UTR and regulate its expression [PMC9120625]. It is also involved in the regulation of SOCS3 in atherosclerotic vascular disease (ASVD) and its expression levels are significantly lower in apoE-/- aortic tissues compared to healthy controls [PMC3641397]. Mmu-mir-30a has been found to be decreased in the mPFC and hippocampus of aged rats compared to controls, and it is involved in the regulation of innate immune system-related genes [PMC6704709]. The DNA sequence of mmu-mir-30a precursor has been obtained from miRBase [PMC6764145]. Upregulation of mmu-mir-30a is associated with liver regeneration, while its downregulation is associated with abnormal morphology in podocyte models [PMC9198802] [PMC6032378]. The probes used for gene expression analysis include mmu-mir-30a [PMC7380117]. References: [PMC3319598] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3319598/ [PMC4346489] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4346489/ [PMC9120625] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9120625/ [PM3641397] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM3641397/ [PM6704709] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM6704709/ [PMC6764145] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6764145/ [PMC9198802] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9198802/ [PMC6032378] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6032378/ [PMC7380117] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7380117/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30a-3p
  2. Anolis carolinensis aca-miR-30a-3p
  3. Cavia porcellus cpo-miR-30a-3p
  4. Chrysemys picta cpi-miR-30a-3p
  5. Columba livia (rock pigeon) cli-miR-30a-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  7. Danio rerio dre-miR-30e-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-3p
  9. Gallus gallus (chicken) gga-miR-30a-3p
  10. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  11. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
  13. Homo sapiens hsa-miR-30a-3p
  14. Ictalurus punctatus ipu-miR-30e
  15. Macaca mulatta (Rhesus monkey) mml-miR-30a-3p
  16. Ophiophagus hannah oha-miR-30a-3p
  17. Ornithorhynchus anatinus oan-miR-30a-3p
  18. Oryctolagus cuniculus ocu-miR-30a-3p
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-30a-3p
  20. Pan troglodytes ptr-miR-30a-3p
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  22. Python bivittatus pbv-miR-30a-3p
  23. Rattus norvegicus (Norway rat) rno-miR-30a-3p
  24. Salmo salar ssa-miR-30d-3p
  25. Sus scrofa (pig) ssc-miR-30a-3p
  26. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  27. Tor tambroides miR-30e-3p
  28. Tursiops truncatus miR-30a-3p
Publications