Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-970-3p URS00000384A0_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUAAGACACACGCGGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Aedes aegypti aae-miR-970
  2. Anopheles gambiae (African malaria mosquito) aga-miR-970
  3. Bactrocera dorsalis bdo-miR-970
  4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-970
  5. Cochliomyia macellaria mature cma-miR-970
  6. Culex quinquefasciatus cqu-miR-970
  7. Drosophila ananassae Dan-Mir-970_3p (mature (guide))
  8. Drosophila mojavensis Dmo-Mir-970_3p (mature (guide))
  9. Drosophila pseudoobscura dps-miR-970-3p
  10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331101_df_nrg
  11. Drosophila simulans dsi-miR-970-3p
  12. Drosophila virilis dvi-miR-970-3p
  13. Drosophila yakuba Dya-Mir-970_3p (mature (guide))
  14. Tribolium castaneum tca-miR-970-3p
Publications