v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-miR-970-3p URS00000384A0_7244

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCAUAAGACACACGCGGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aedes aegypti aae-miR-970
  2. Anopheles gambiae aga-miR-970
  3. Bactrocera dorsalis bdo-miR-970
  4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-970
  5. Cochliomyia macellaria mature cma-miR-970
  6. Culex quinquefasciatus (southern house mosquito) cqu-miR-970
  7. Drosophila ananassae Dan-Mir-970_3p (mature (guide))
  8. Drosophila melanogaster (fruit fly) dme-miR-970-3p
  9. Drosophila mojavensis Dmo-Mir-970_3p (mature (guide))
  10. Drosophila pseudoobscura dps-miR-970-3p
  11. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0331101_df_nrg
  12. Drosophila simulans dsi-miR-970-3p
  13. Drosophila yakuba Dya-Mir-970_3p (mature (guide))
  14. Glossina pallidipes (tsetse fly) Gpa-Mir-970_3p (mature (guide))
  15. Tribolium castaneum (red flour beetle) tca-miR-970-3p
 Relationships

Molecular Relationships