v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-970 URS00000384A0_7159

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCAUAAGACACACGCGGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-970
  2. Bactrocera dorsalis bdo-miR-970
  3. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-970
  4. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-970
  5. Culex quinquefasciatus cqu-miR-970
  6. Drosophila ananassae Dan-Mir-970_3p (mature (guide))
  7. Drosophila melanogaster dme-miR-970-3p
  8. Drosophila mojavensis Dmo-Mir-970_3p (mature (guide))
  9. Drosophila pseudoobscura dps-miR-970-3p
  10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331101_df_nrg
  11. Drosophila simulans dsi-miR-970-3p
  12. Drosophila virilis dvi-miR-970-3p
  13. Drosophila yakuba Dya-Mir-970_3p (mature (guide))
  14. Tribolium castaneum tca-miR-970-3p
 Publications