Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tribolium castaneum (red flour beetle) Tca-Mir-137-v2_3p (mature (guide)) URS000001B36D_7070

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tribolium castaneum. Annotated by 1 database (MirGeneDB). Described in 1 paper. Found in the red flour beetle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCUUGAGAAUACACGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Acyrthosiphon pisum api-miR-137
    2. Aedes aegypti (yellow fever mosquito) aae-miR-137
    3. Anopheles gambiae (African malaria mosquito) aga-miR-137
    4. Bactrocera dorsalis bdo-miR-137
    5. Blattella germanica Bge-Mir-137-P14-v2_3p (mature (guide))
    6. Capitella teleta cte-miR-137
    7. Culex quinquefasciatus (southern house mosquito) cqu-miR-137
    8. Dasypus novemcinctus Dan-Mir-137_3p (mature (guide))
    9. Drosophila melanogaster (fruit fly) dme-miR-137-3p
    10. Drosophila mojavensis Dmo-Mir-137_3p (mature (guide))
    11. Drosophila pseudoobscura dps-miR-137-3p
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330769_df_nrg
    13. Drosophila simulans dsi-miR-137-3p
    14. Drosophila virilis dvi-miR-137-3p
    15. Eisenia fetida (common brandling worm) Efe-Mir-137-P5_3p (mature (guide))
    16. Lingula anatina Lan-Mir-137_3p (mature (guide))
    17. Lytechinus variegatus (green sea urchin) lva-miR-137-3p
    18. Manduca sexta (tobacco hornworm) mse-miR-137
    19. Patiria miniata pmi-miR-137-3p
    20. Ptychodera flava Pfl-Mir-137-v1_3p (mature (guide))
    21. Saccoglossus kowalevskii sko-miR-137
    22. Strongylocentrotus purpuratus spu-miR-137