v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-6529a URS000075A109_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-6529a: Bta-mir-6529a is a DA miRNA that is upregulated in Y sperm and is involved in catabolic processes in the mature oocyte [PMC7505075]. It is one of the 12 DA miRNAs that overlap between two different software and is enriched in Y sperm [PMC7505075]. Bta-mir-6529a plays a negative role in regulating the proliferation and differentiation of yak preadipocytes, and its expression is negatively regulated by lncFAM200B [PMC9368248]. The expression levels of bta-mir-6529a are significantly decreased after lncFAM200B overexpression in preadipocytes [PMC9368248]. Bta-mir-6529a is a highly abundant cattle miRNA, ranking as the 39th most abundant RNA transcript [PMC4726401]. It does not have any known miRNA homolog in human miRbase [PMC4726401].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAGAUCAGAGGCGCAGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-6529
  2. Canis lupus familiaris Cfa-Mir-6529_5p (mature (guide))
  3. Cavia porcellus cpo-miR-6529-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-6529-5p
  5. Daubentonia madagascariensis (aye-aye) dma-miR-6529
  6. Homo sapiens Hsa-Mir-6529_5p (mature (guide))
  7. Macaca mulatta mml-miR-6529-5p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-6529-5p
  9. Otolemur garnettii (small-eared galago) oga-miR-6529
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-6529
  11. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-6529
  12. Sus scrofa (pig) ssc-miR-6529
  13. Tupaia chinensis tch-miR-6529
 Publications