Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-6529 URS000075A109_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAGAUCAGAGGCGCAGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus bta-miR-6529a
  2. Canis lupus familiaris Cfa-Mir-6529_5p (mature (guide))
  3. Cavia porcellus cpo-miR-6529-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-6529-5p
  5. Daubentonia madagascariensis (aye-aye) dma-miR-6529
  6. Homo sapiens Hsa-Mir-6529_5p (mature (guide))
  7. Macaca mulatta mml-miR-6529-5p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-6529-5p
  9. Otolemur garnettii (small-eared galago) oga-miR-6529
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-6529
  11. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-6529
  12. Sus scrofa (pig) ssc-miR-6529
  13. Tupaia chinensis tch-miR-6529