Dasypus novemcinctus (nine-banded armadillo) dno-miR-6529-5p URS000075A109_9361

• 21 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 13 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GAGAGAUCAGAGGCGCAGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Bos taurus bta-miR-6529a
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-6529
3. Canis lupus familiaris Cfa-Mir-6529_5p (mature (guide))
4. Cavia porcellus cpo-miR-6529-5p
5. Daubentonia madagascariensis (aye-aye) dma-miR-6529
6. Homo sapiens Hsa-Mir-6529_5p (mature (guide))
7. Macaca mulatta mml-miR-6529-5p
8. Oryctolagus cuniculus (rabbit) ocu-miR-6529-5p
9. Otolemur garnettii (small-eared galago) oga-miR-6529
10. Pongo pygmaeus (Bornean orangutan) ppy-miR-6529
11. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-6529
12. Sus scrofa (pig) ssc-miR-6529
13. Tupaia chinensis tch-miR-6529

Download

• FASTA
• JSON