v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Otolemur garnettii (small-eared galago) oga-miR-6529 URS000075A109_30611

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAGAUCAGAGGCGCAGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus bta-miR-6529a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-6529
  3. Canis lupus familiaris Cfa-Mir-6529_5p (mature (guide))
  4. Cavia porcellus cpo-miR-6529-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-6529-5p
  6. Daubentonia madagascariensis (aye-aye) dma-miR-6529
  7. Homo sapiens Hsa-Mir-6529_5p (mature (guide))
  8. Macaca mulatta mml-miR-6529-5p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-6529-5p
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-6529
  11. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-6529
  12. Sus scrofa (pig) ssc-miR-6529
  13. Tupaia chinensis tch-miR-6529