v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small Cajal body-specific RNA 17 (SCARNA17) URS00004D18E1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA17: SCARNA17 is a small Cajal body-specific RNA 17 [PMC5612246]. RNA from cells with reduced SCARNA17 levels showed increased A484 methylation, indicated by an increased pause signal, compared to control siRNA treated cells [PMC5612246]. In vitro generated fragments of SCARNA17 were found to be approximately the same size as those found in cells expressing scaRNA2 and SCARNA17 constructs [PMC7648615]. Ct-values for mRNA and miRNA species were normalized to housekeeping genes such as TBP, HPRT1, CycloA, and β-Actin for mRNAs and primary/precursor miRNAs [PMC3541122].

Targeting miRNAs 19 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGGCUUGGGCCGCCGAGCUGGACCCGGACCGGUUUUGGGUACUGUACUGGGGGCAGGGCAGAGAGGUGGGCGGCAGUUGGGGUGCGGUGAUUGUAGUAGGCUAGGGCGCUUUCGGGUCCCCAUUGCAGCCCCCGGAUGAGCCCGCAGUAUUUUCCUUAUAUGAUCAGGUCCCAUUGCGGGCGGCGCCGCUUGCCCGGAGCCUGAGAGGAUUAUGAAAACGUGGCGAGCGAAAUGGGGCCAGGGGACCUGGAGCAGGGGCGUGAGGAGAGUAGGCAGCGGGUGAGGCUGGACGGGAGGGAGGUCUAGGGAGGCCUCUGCCGCGGGCACUGUGAGUCCUGGCCGAUGAUGACGAGACCACUGCGCAAUCUGAGUUCUGGGAACCAGGUGAUGGAGUAUGUUCUGAGAACAGACUGAGGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications