Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-766-3p URS00001012BC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-766: Hsa-mir-766 is a microRNA that has been studied in various contexts. It has been identified as one of the most informative miRNAs in a study on breast cancer [PMC4439119]. It has also been found to be shared among different groups in a study on miRNA expression in colorectal cancer [PMC3462109]. In another study on Alzheimer's disease, the genes encoding hsa-mir-766 were found to be potentially relevant for biomarker and therapeutic development [PMC6815273]. Hsa-mir-766 has been identified as one of the upregulated miRNAs in hepatocellular carcinoma [PMC3563587]. It has also been associated with circRNA interactions and potential target sites for other miRNAs [PMC7063791]. Hsa-mir-766 is among the top-ranked miRNAs in a study on gastric cancer [PMC5072262]. It is one of the miRNA precursors with previously unreported antisense transcripts [PMC3722126]. Hsa-mir-766 has also been found to be differentially expressed before and after deployment, along with other microRNAs, as observed in a study on military personnel [PMC8158372]. In cervical cancer, hsa-mir-766 is upregulated and associated with other common miRNAs involved in the disease [PMC8324362]. Finally, hsa-mir-766 is among the upregulated microRNAs involved in pulpal inflammation [PMC9987318].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCCAGCCCCACAGCCUCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-766 (MIR766)
  2. Gorilla gorilla ggo-miR-766
  3. Pan troglodytes ptr-miR-766
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-766
Publications