Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-130b-3p URS00002C0FCB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-130b: Hsa-mir-130b is a microRNA that is of statistical relevance in F3+ as it does not belong to any of the two clusters, unlike the other miRNAs [PMC3078861]. In a patient cohort of B-ALL, it was found that hsa-mir-130b was downregulated by IK1 and its high expression correlated with a worse overall outcome [PMC9624360]. In this cohort, several other genes were found to be either upregulated or downregulated [PMC10048937]. The upregulated genes included hsa-miR-22, hsa-mir-130b, hsa-miR-146b-5p, hsa-miR-223, hsa-miR-301a, hsa-miR-484, hsa-miR-663, hsa-miR-720, hsa-miR-1260, hsa-miR-1274a, hsa-miR-1274b, hsa-miR-3663-3p, hsa-miR-4281, and hsa-miR-4286 [PMC10048937].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGAUGAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-130b
  2. Callithrix jacchus cja-miR-130b
  3. Canis lupus familiaris (dog) cfa-miR-130b
  4. Capra hircus (goat) chi-miR-130b-3p
  5. Cavia porcellus cpo-miR-130b-3p
  6. Cricetulus griseus cgr-miR-130b-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130b-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P4a_3p (mature (guide))
  9. Equus caballus eca-miR-130b
  10. Macaca mulatta (Rhesus monkey) mml-miR-130b-3p
  11. Mus musculus (house mouse) mmu-miR-130b-3p
  12. Oryctolagus cuniculus ocu-miR-130b-3p
  13. Pan troglodytes ptr-miR-130b
  14. Pongo pygmaeus ppy-miR-130b
  15. Rattus norvegicus (Norway rat) rno-miR-130b-3p
  16. Sus scrofa ssc-miR-130b-3p
  17. Xenopus laevis (African clawed frog) xla-miR-130b-3p
  18. Xenopus tropicalis (tropical clawed frog) xtr-miR-130b
Publications