v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-338 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-338 precursor URS000075E706_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir338: MIR338 is a microRNA implicated in the regulation of osteoblast lineage priming in bone marrow stromal cells, as single-cell transcriptomic analysis has shown that the ablation of MIR338 can restore this priming ability [PMC9898552]. This finding was further supported by evidence from a conditional knockdown of the MIR338 cluster specifically in the preosteoblast lineage, confirming its role in osteogenesis [PMC9898552]. Additionally, MIR338 has been studied for its diagnostic potential in hepatocellular carcinoma (HCC), with a comprehensive search for related studies conducted across multiple databases up to December 15, 2016 [PMC5783480]. This search was aimed at evaluating the diagnostic value of miR-338-5p, a specific variant of MIR338, by reviewing studies from databases such as GEO, PubMed, Embase, Cochrane Library, Web of Science, Sinomed, Chinese VIP database, Wanfang database and China National Knowledge Infrastructure (CNKI) [PMC5783480].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCCAACAAUAUCCUGGUGCUGAGUGAUGACUCAGGCGACUCCAGCAUCAGUGAUUUUGUUGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-338
  2. Gorilla gorilla microRNA mir-338
  3. Nomascus leucogenys microRNA mir-338
  4. Pan paniscus (pygmy chimpanzee) microRNA mir-338
  5. Pan troglodytes microRNA mir-338
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 GoFlow Results Publications