v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (pygmy chimpanzee) microRNA mir-338 secondary structure diagram

Pan paniscus (pygmy chimpanzee) microRNA mir-338 URS000075E706_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCCAACAAUAUCCUGGUGCUGAGUGAUGACUCAGGCGACUCCAGCAUCAGUGAUUUUGUUGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-338
  2. Gorilla gorilla microRNA mir-338
  3. Homo sapiens microRNA hsa-mir-338 precursor
  4. Nomascus leucogenys microRNA mir-338
  5. Pan troglodytes microRNA mir-338
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...