Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-27b precursor URS000075B0A5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR27B: MIR27B is a microRNA that has been implicated in various biological processes and diseases [PMC5933288]. It has been found to play a role in thymic involution, with Wnt4 acting as a key inhibitor [PMC5933288]. In breast cancer, the reduction of MIR27B induced by CCL18 promotes invasion and migration of cancer cells [PMC4653020]. In patients with temporal lobe epilepsy (TLE), several miRNA families and clusters, including MIR27B, were found to be differentially methylated compared to controls [PMC9700089]. Additionally, MIR27B, along with miR-101 and miR-128, has been shown to downregulate VEGFC expression and suppress tumor growth, metastasis, invasion, migration, and angiogenesis in gastric cancer, bladder cancer, and hepatocellular carcinoma [PMC7780026]. Furthermore, it is suggested that MIR27B could directly regulate HIV-1 transcription [PMC3697138].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications