v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) miRNA URS000075B0A5_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Cercocebus atys microRNA 27b (ENSCATG00000019644.1)
  2. Gorilla gorilla gorilla microRNA 27b (ENSGGOG00000032633.2)
  3. Homo sapiens microRNA hsa-mir-27b precursor
  4. Macaca mulatta microRNA mml-mir-27b precursor
  5. Macaca nemestrina (Pig-tailed macaque) microRNA 27b (ENSMNEG00000018023.1)
  6. Mandrillus leucophaeus (Drill) microRNA 27b (ENSMLEG00000010705.1)
  7. Microcebus murinus (gray mouse lemur) microRNA 27b (ENSMICG00000018924.3)
  8. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 27b (ENSNLEG00000020445.2)
  9. Otolemur garnettii (small-eared galago) microRNA 27b (ENSOGAG00000017601.1)
  10. Pan paniscus (bonobo) microRNA 27b (ENSPPAG00000020887.1)
  11. Pan troglodytes ptr-mir-27b (ENSPTRG00000027653.2)
  12. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-27b precursor
  13. Propithecus coquereli (Coquerel's sifaka) microRNA 27b (ENSPCOG00000010670.1)
  14. Rattus norvegicus (Norway rat) microRNA rno-mir-27b precursor
  15. Tupaia belangeri microRNA 27b (ENSTBEG00000017927.1)