v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-181a precursor (mmu-mir-181a-2) secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-181a precursor (mmu-mir-181a-2) URS000075A833_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAUGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUCAAAAACAAAAAAACCACCGACCGUUGACUGUACCUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Mus caroli microRNA 181a-2 (MGP_CAROLIEiJ_G0007712.1)
  2. Mus spretus (algerian mouse) microRNA 181a-2 (MGP_SPRETEiJ_G0008101.1)
 2D structure Publications