Mus spretus (algerian mouse) microRNA 181a-2 (MGP_SPRETEiJ_G0008101.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus spretus (algerian mouse) microRNA 181a-2 (MGP_SPRETEiJ_G0008101.1) URS000075A833_10096

76 nucleotides
1 database (Ensembl)
Found in 2 other species
2 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCAUGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUCAAAAACAAAAAAACCACCGACCGUUGACUGUACCUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Mus caroli microRNA 181a-2 (MGP_CAROLIEiJ_G0007712.1)
Mus musculus microRNA mmu-mir-181a precursor (mmu-mir-181a-2)

2D structure

Publications