Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-761 URS000075A6C8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-761: Hsa-mir-761 is a microRNA that has been implicated in various biological processes and diseases [PMC7279016]. It has been shown that FENDRR can sequester hsa-mir-761, leading to the release of the metalloproteinase inhibitor TIMP2 [PMC7279016]. Additionally, hsa-mir-761, along with other microRNAs such as hsa-miR-15b-5p, hsa-miR-151a-5p, and hsa-miR-196a-5p, targets the S protein gene 54 [PMC9346380]. Interestingly, hsa-mir-761 and hsa-miR-298 are targets of several circular RNAs including hsa-circRNA_003251 and hsa-circRNA_005019 [PMC5544722]. Furthermore, a study identified nine miRNAs including hsa-mir-761 as well as four long non-coding RNAs (lncRNAs) as hub RNAs in a competing endogenous RNA (ceRNA) network [PMC7076920]. The top five predicted target miRNAs of another circular RNA called hsa-circRNA_003251 include hsa-mir-761 [PMC5544722]. Overall, these studies highlight the importance of understanding the functions and interactions of microRNAs like hsa-mir-761 in various biological contexts [PMC7221196].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGCAGGGUGAAACUGACACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus bta-miR-761
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-761
  3. Canis lupus familiaris cfa-miR-761
  4. Equus caballus (horse) eca-miR-761
  5. Macaca mulatta mml-miR-761
  6. Mus musculus mmu-miR-761
  7. Pan troglodytes ptr-miR-761
  8. Rattus norvegicus (Norway rat) rno-miR-761
Publications