v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-761 URS000075A6C8_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGCAGGGUGAAACUGACACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus bta-miR-761
  2. Canis lupus familiaris cfa-miR-761
  3. Equus caballus (horse) eca-miR-761
  4. Homo sapiens hsa-miR-761
  5. Macaca mulatta mml-miR-761
  6. Mus musculus mmu-miR-761
  7. Pan troglodytes ptr-miR-761
  8. Rattus norvegicus (Norway rat) rno-miR-761