Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-761 URS000075A6C8_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-761: Mmu-mir-761 is a microRNA that has been predicted to target LCN2 according to three databases [PMC7147028]. It is also involved in the adipocytokine signaling pathway along with mmu-miR-715, which targets Stk11, Slc2a1, Rxrg, Ppara, Tnfrsf1a, and Acacb [PMC3573770]. The regulation of mRNA targets of mmu-miR-669c, mmu-miR-329 (up-regulated), and mmu-miR-688, mmu-miR-30c-1*, mmu-miR-201, mmu-mir-761, and mmu-miR-715 (down-regulated) in Tff2-KO mice was visualized using the Cytoscape program [PMC3573770]. Mmu-mir-761 is a common target miRNA of Steap3 and Gclc in a network that includes 122 miRNAs [PMC10116744]. It has also been predicted to bind four sites within 3′UTR along with other miRNAs such as mmu-miR-10a, mmu-miR10b, and others [PMC4902921]. In the intestinal tissues of UC mice, the expression levels of target miRNAs IL25 (down-regulated), mmu-mir761 (down-regulated), and others were confirmed using RT-qPCR assay [PMC8291871]. Furthermore, RT-qPCR showed that in UC intestinal tissue samples there was down-regulation of expression levels for mmumir761 as well as other miRNAs such as mmmiuMIR135b5p (up-regulated) [PMC8291871]. Mmu mir 761 has also been implicated in regulating the expression levels of Top2a, Cd44, Ms4a6c, and KNSTRN through circRNA.7078 [PMC8447959]. Additionally, circRNA.7079 may affect the expression of target mRNAs by sponging mmu-miR-326-5p, mmu-mir-761, mmu-miR-1907, or mmu-miR-3473 [PMC8447959].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGCAGGGUGAAACUGACACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus bta-miR-761
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-761
  3. Canis lupus familiaris cfa-miR-761
  4. Equus caballus (horse) eca-miR-761
  5. Homo sapiens hsa-miR-761
  6. Macaca mulatta mml-miR-761
  7. Pan troglodytes ptr-miR-761
  8. Rattus norvegicus (Norway rat) rno-miR-761
Publications