v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bombus terrestris (Buff-tailed bumblebee) microRNA mir-263 secondary structure diagram

Bombus terrestris (Buff-tailed bumblebee) microRNA mir-263 URS000070F702_30195

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGGUUCUGGCGGGUCUUGGCACUGGAAGAAUUCACAGAUGUGCAGUGUAUAAUCGUGGAUCUUGCAAUGCCAUCACUUGCUGGAUACCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Apis florea microRNA mir-263
  2. Apis mellifera microRNA ame-mir-263b precursor
  3. Dufourea novaeangliae microRNA mir-263
  4. Melipona quadrifasciata microRNA mir-263
 2D structure Publications