v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Apis mellifera (honey bee) microRNA ame-mir-263b precursor secondary structure diagram

Apis mellifera (honey bee) microRNA ame-mir-263b precursor URS000070F702_7460

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGGUUCUGGCGGGUCUUGGCACUGGAAGAAUUCACAGAUGUGCAGUGUAUAAUCGUGGAUCUUGCAAUGCCAUCACUUGCUGGAUACCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Apis florea microRNA mir-263
  2. Bombus terrestris (Buff-tailed bumblebee) microRNA mir-263
  3. Dufourea novaeangliae microRNA mir-263
  4. Melipona quadrifasciata microRNA mir-263
 2D structure Publications