v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) mir-154 microRNA precursor family URS00006A5ABA_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGAAACAUACACGGGAAACCUCUUUUUUAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Balaenoptera musculus (Blue whale) microRNA 494 (ENSBMSG00010004592.1)
  2. Camelus dromedarius (Arabian camel) microRNA 494 (ENSCDRG00005004919.1)
  3. Camelus ferus (Wild Bactrian camel) mir-154 microRNA precursor family
  4. Canis lupus dingo (dingo) microRNA 494 (ENSCAFG00020010860.1)
  5. Canis lupus familiaris microRNA cfa-mir-494 precursor
  6. Colobus angolensis palliatus miRNA (ENSCANG00000019431.1)
  7. Dasypus novemcinctus (nine-banded armadillo) microRNA 494 (ENSDNOG00000028742.1)
  8. Delphinapterus leucas (beluga whale) microRNA 494 (ENSDLEG00000001963.1)
  9. Equus caballus microRNA eca-mir-494 precursor
  10. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 494 (ENSGGOG00000028889.2)
  11. Homo sapiens microRNA hsa-mir-494 precursor
  12. Pan paniscus (bonobo) microRNA 494 (ENSPPAG00000014924.1)
  13. Pan troglodytes ptr-mir-494 (ENSPTRG00000027598.2)
  14. Phocoena sinus (vaquita) microRNA 494 (ENSPSNG00000000753.1)
  15. Physeter catodon microRNA 494 (ENSPCTG00005017359.1)
  16. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-494 precursor
  17. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000007832.1)
  18. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 494 (ENSRFEG00010004088.1)
  19. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000012367.1)
  20. Rhinopithecus roxellana miRNA (ENSRROG00000006734.1)
  21. Tursiops truncatus miRNA (ENSTTRG00000023449.1)
  22. Vulpes vulpes (red fox) miRNA (ENSVVUG00000028590.1, ENSVVUG00000028592.1)
 Publications