Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-494 precursor URS00006A5ABA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR494: MIR494 is a microRNA that has been found to play a role in various biological processes, particularly in cancer [PMC4722626]. It has been observed that MIR494 expression leads to a reduction in cholesterol levels, which is associated with increased cell death and an apoptotic response [PMC4722626]. This suggests that MIR494 may contribute to the regulation of cellular viability. Additionally, MIR494 has been identified as an oncogenic miRNA that is upregulated in various cancers, along with miR155-5p, miR493, and miR519a [PMC9775527]. These findings highlight the potential significance of MIR494 in cancer development and progression. Furthermore, MIR494 has been found to regulate the expression of ATF3 and JUN [PMC4774345]. ATF3 is a transcription factor involved in cellular stress response and JUN is a proto-oncogene involved in cell proliferation and differentiation. The regulation of these genes by MIR494 suggests its involvement in modulating key signaling pathways associated with cancer development [PMC4774345]. Overall, these studies provide insights into the role of MIR494 as an oncogenic microRNA involved in cholesterol regulation and the modulation of key genes implicated in cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGAAACAUACACGGGAAACCUCUUUUUUAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

Publications