Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63160 URS000061B694_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis (American alligator) ami-miR-146b-5p
  2. Canis lupus familiaris cfa-miR-146b
  3. Equus caballus eca-miR-146b-5p
  4. Homo sapiens hsa-miR-146b-5p
  5. Macaca mulatta (Rhesus monkey) mml-miR-146b-5p
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146b-5p
  7. Mus musculus mmu-miR-146b-5p
  8. Ornithorhynchus anatinus (platypus) oan-miR-146b-5p
  9. Pan troglodytes (chimpanzee) ptr-miR-146b
  10. Petromyzon marinus pma-miR-146-5p
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-146b-5p