v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Petromyzon marinus (sea lamprey) pma-miR-146-5p URS000061B694_7757

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGAACUGAAUUCCAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis (American alligator) ami-miR-146b-5p
  2. Canis lupus familiaris cfa-miR-146b
  3. Equus caballus eca-miR-146b-5p
  4. Homo sapiens hsa-miR-146b-5p
  5. Macaca mulatta (Rhesus monkey) mml-miR-146b-5p
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146b-5p
  7. Mus musculus mmu-miR-146b-5p
  8. Ornithorhynchus anatinus (platypus) oan-miR-146b-5p
  9. Pan troglodytes (chimpanzee) ptr-miR-146b
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-146b-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63160