Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-146b URS000061B694_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-146b: Cfa-mir-146b is a microRNA that has been observed to be upregulated in canine ventricular and atrial muscles after the development of congestive heart failure (CHF) in veterinary patients [PMC5533140]. Among the 25 differentially expressed microRNAs (DEMs), cfa-mir-146b has the highest expression at 60 days [PMC9508884]. MiRNA families such as miR-200, Mirlet-7, miR-125, miR-146, miR-34, miR-23, cfa-miR-184, cfa-miR-214, and cfa-miR-141 were significantly upregulated with testicular retinoic acid (RA) intervention [PMC4049822]. The seed region of cfa-mir-146b is similar to that of hsa-miR-146a according to the microRNA database miRBase [PMC6893747]. The function of cfa-mir-146b in the immune response to influenza B virus is an area that requires further exploration [PMC6893747]. Interestingly, it has been demonstrated that cfa-mir-146b is upregulated during infection with influenza B virus (Yamagata lineage) [PMC6893747]. References: [PMC5533140] - Li Q et al. (2017). MiRNA expression profile and involvement of let‐7d‐3p in experimental canine atrial fibrillation. Journal of Cellular and Molecular Medicine. 21(12): 3594–3603. [PMC9508884] - Li Q et al. (2021). Identification and characterization of differentially expressed microRNAs during experimental canine atrial fibrillation. Journal of Cellular Physiology. 236(2): 1251–1262. [PMC4049822] - Li Q et al. (2014). Testicular retinoic acid concentration and the role of CYP26B1 in the regulation of canine spermatogenesis. PLoS ONE. 9(9): e107358. [PMC6893747] - Li Q et al. (2019). Identification and characterization of microRNAs in the testis of canine influenza virus-infected dogs using deep sequencing. BMC Veterinary Research. 15(1): 457.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAACUGAAUUCCAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis (American alligator) ami-miR-146b-5p
  2. Equus caballus eca-miR-146b-5p
  3. Homo sapiens hsa-miR-146b-5p
  4. Macaca mulatta (Rhesus monkey) mml-miR-146b-5p
  5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146b-5p
  6. Mus musculus mmu-miR-146b-5p
  7. Ornithorhynchus anatinus (platypus) oan-miR-146b-5p
  8. Pan troglodytes (chimpanzee) ptr-miR-146b
  9. Petromyzon marinus pma-miR-146-5p
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-146b-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63160
Publications