Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-151 URS00005F8E5B_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-151: Cfa-mir-151 is a microRNA that has been identified as a regulator of IgSF genes [PMC7689213]. In a study comparing dogs with mitral valve disease (MMVD) to healthy dogs, cfa-mir-151 was found to be significantly upregulated in the eccentric hypertrophy group [PMC8062772]. In another study comparing dogs with various heart diseases, cfa-mir-151 was found to be significantly upregulated in the group with patent ductus arteriosus (PDA) [PMC8542680]. Additionally, the 5' seed region of cfa-mir-151 was found to be partially complementary to the mRNA of NP and NS1 of the avian influenza H3N2 virus [PMC8779696]. These findings suggest that cfa-mir-151 may play a role in cardiac hypertrophy and potentially have implications in viral infections. Further research is needed to fully understand the function and significance of cfa-mir-151 in these contexts [PMC8062772][PMC8542680][PMC8779696].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGAGGAGCUCACAGUCUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-151-5p
  2. Capra hircus chi-miR-151-5p
  3. Cervus elaphus (red deer) cel-miR-151*
  4. Cricetulus griseus cgr-miR-151-5p
  5. Daubentonia madagascariensis (aye-aye) dma-miR-151
  6. Equus caballus eca-miR-151-5p
  7. Homo sapiens hsa-miR-151a-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-151-5p
  9. Mus musculus (house mouse) mmu-miR-151-5p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-151-5p
  11. Otolemur garnettii (small-eared galago) oga-miR-28b
  12. Papio hamadryas (hamadryas baboon) pha-miR-151
  13. Pongo pygmaeus ppy-miR-151a-5p
  14. Pteropus alecto pal-miR-151-5p
  15. Rattus norvegicus rno-miR-151-5p
  16. Sus scrofa ssc-miR-151-5p
  17. Tursiops truncatus (common bottlenose dolphin) miR-151
Publications