Pongo pygmaeus (Bornean orangutan) ppy-miR-151a-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-151a-5p URS00005F8E5B_9600

21 nucleotides
1 database (miRBase)
Found in 17 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCGAGGAGCUCACAGUCUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Bos taurus bta-miR-151-5p
Canis lupus familiaris (dog) cfa-miR-151
Capra hircus chi-miR-151-5p
Cervus elaphus (red deer) cel-miR-151*
Cricetulus griseus cgr-miR-151-5p
Daubentonia madagascariensis (aye-aye) dma-miR-151
Equus caballus eca-miR-151-5p
Homo sapiens hsa-miR-151a-5p
Macaca mulatta (Rhesus monkey) mml-miR-151-5p
Mus musculus (house mouse) mmu-miR-151-5p
Oryctolagus cuniculus (rabbit) ocu-miR-151-5p
Otolemur garnettii (small-eared galago) oga-miR-28b
Papio hamadryas (hamadryas baboon) pha-miR-151
Pteropus alecto pal-miR-151-5p
Rattus norvegicus rno-miR-151-5p
Sus scrofa ssc-miR-151-5p
Tursiops truncatus (common bottlenose dolphin) miR-151