Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-151-5p URS00005F8E5B_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGAGGAGCUCACAGUCUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-151-5p
  2. Canis lupus familiaris (dog) cfa-miR-151
  3. Capra hircus chi-miR-151-5p
  4. Cervus elaphus (red deer) cel-miR-151*
  5. Cricetulus griseus cgr-miR-151-5p
  6. Daubentonia madagascariensis (aye-aye) dma-miR-151
  7. Equus caballus eca-miR-151-5p
  8. Homo sapiens hsa-miR-151a-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-151-5p
  10. Mus musculus (house mouse) mmu-miR-151-5p
  11. Otolemur garnettii (small-eared galago) oga-miR-28b
  12. Papio hamadryas (hamadryas baboon) pha-miR-151
  13. Pongo pygmaeus ppy-miR-151a-5p
  14. Pteropus alecto pal-miR-151-5p
  15. Rattus norvegicus rno-miR-151-5p
  16. Sus scrofa ssc-miR-151-5p
  17. Tursiops truncatus (common bottlenose dolphin) miR-151
Publications