Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-133a precursor (hsa-mir-133a-1) URS00005EB596_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR133A1: MIR133A1 is a gene that encodes miR-133a1, a mature microRNA in humans. It is located at 18q11.2 [PMC3323546]. miR-133a is mainly expressed in muscles and plays a role in controlling the pathogenesis of insulin resistance [PMC7913585]. MIR133A1, along with MIR133A2, promotes muscle differentiation and expression during myogenesis [PMC5137429]. In glioma samples, MIR133A1 was found to be downregulated [PMC8634738]. It is also expressed during pluripotent stem cell differentiation into the cardiac lineage [PMC6828809]. MIR133A1 and MIR133A2 are involved in promoting pre-cardiac mesoderm while suppressing endodermal and neuroectodermal lineages [PMC6828809]. In the context of familial atrial fibrillation, genetic screening of the MIR133A1 gene was performed [PMC3599331]. Alterations in MIR133A1 were observed in pancreatic ductal adenocarcinoma patients [PMC9599289]. Overexpression of TF ESF1 downregulates miRNA MIR133A1 to upregulate the target gene EGFR in prostate tumors [PMC8840188]. Additionally, 11 genes were found to be common between two top 20 lists, including MIR133A1 [PMC6890825].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000012804.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-133a precursor
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-mir-133a-1 (ENSCJAG00000029861.3)
  4. Camelus dromedarius microRNA 133a-1 (ENSCDRG00005019943.1)
  5. Catagonus wagneri (Chacoan peccary) microRNA 133a-1 (ENSCWAG00000006152.1)
  6. Cebus imitator microRNA 133a-1 (ENSCCAG00000019759.1)
  7. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000019782.1)
  8. Chlorocebus sabaeus microRNA 133a-1 (ENSCSAG00000026563.1)
  9. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000004291.1, ENSCANG00000004317.1)
  10. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-133a (ENSGGOG00000028916.2)
  11. Gorilla gorilla microRNA ggo-mir-133a precursor
  12. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-133a precursor
  13. Macaca fascicularis (Crab-eating macaque) microRNA 133a-1 (ENSMFAG00000013543.2)
  14. Macaca mulatta microRNA mml-mir-133a precursor
  15. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-133a precursor
  16. Microcebus murinus (gray mouse lemur) microRNA 133a-1 (ENSMICG00000037122.2)
  17. Nomascus leucogenys microRNA 133a-1 (ENSNLEG00000019487.2)
  18. Oryctolagus cuniculus (rabbit) microRNA 133a-1 (ENSOCUG00000018089.1)
  19. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017271.2)
  20. Pan paniscus microRNA ppa-mir-133a precursor
  21. Pan troglodytes microRNA ptr-mir-133a precursor (ptr-mir-133a-1)
  22. Papio anubis (olive baboon) miRNA (ENSPANG00000015403.3)
  23. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000035572.1)
  24. Pongo abelii miRNA (ENSPPYG00000021375.2)
  25. Pongo pygmaeus microRNA ppy-mir-133a precursor
  26. Prolemur simus miRNA (ENSPSMG00000011173.1)
  27. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000002056.1)
  28. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000010221.1)
  29. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000022251.1)
  30. Saguinus labiatus microRNA sla-mir-133a precursor
  31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000010525.1)
  32. Theropithecus gelada microRNA 133a-1 (ENSTGEG00000015696.1)
  33. Tupaia belangeri miRNA (ENSTBEG00000017882.1)
  34. Vicugna pacos miRNA (ENSVPAG00000016649.1)
Publications