Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) microRNA ptr-mir-133a precursor (ptr-mir-133a-1) URS00005EB596_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000012804.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-133a precursor
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-mir-133a-1 (ENSCJAG00000029861.3)
  4. Camelus dromedarius microRNA 133a-1 (ENSCDRG00005019943.1)
  5. Catagonus wagneri (Chacoan peccary) microRNA 133a-1 (ENSCWAG00000006152.1)
  6. Cebus imitator microRNA 133a-1 (ENSCCAG00000019759.1)
  7. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000019782.1)
  8. Chlorocebus sabaeus microRNA 133a-1 (ENSCSAG00000026563.1)
  9. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000004291.1, ENSCANG00000004317.1)
  10. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-133a (ENSGGOG00000028916.2)
  11. Gorilla gorilla microRNA ggo-mir-133a precursor
  12. Homo sapiens (human) microRNA hsa-mir-133a precursor (hsa-mir-133a-1)
  13. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-133a precursor
  14. Macaca fascicularis (Crab-eating macaque) microRNA 133a-1 (ENSMFAG00000013543.2)
  15. Macaca mulatta microRNA mml-mir-133a precursor
  16. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-133a precursor
  17. Microcebus murinus (gray mouse lemur) microRNA 133a-1 (ENSMICG00000037122.2)
  18. Nomascus leucogenys microRNA 133a-1 (ENSNLEG00000019487.2)
  19. Oryctolagus cuniculus (rabbit) microRNA 133a-1 (ENSOCUG00000018089.1)
  20. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017271.2)
  21. Pan paniscus microRNA ppa-mir-133a precursor
  22. Papio anubis (olive baboon) miRNA (ENSPANG00000015403.3)
  23. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000035572.1)
  24. Pongo abelii miRNA (ENSPPYG00000021375.2)
  25. Pongo pygmaeus microRNA ppy-mir-133a precursor
  26. Prolemur simus miRNA (ENSPSMG00000011173.1)
  27. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000002056.1)
  28. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000010221.1)
  29. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000022251.1)
  30. Saguinus labiatus microRNA sla-mir-133a precursor
  31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000010525.1)
  32. Theropithecus gelada microRNA 133a-1 (ENSTGEG00000015696.1)
  33. Tupaia belangeri miRNA (ENSTBEG00000017882.1)
  34. Vicugna pacos miRNA (ENSVPAG00000016649.1)
Publications