Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-133a precursor (hsa-mir-133a-1) URS00005EB596_9606

  • 88 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 33 species

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, Ensembl/GENCODE, RefSeq, MalaCards, HGNC, ENA, Ensembl, GeneCards). Described in 49 papers. Matches 1 Rfam family (mir-133, RF00446). Homo sapiens (human) microRNA hsa-mir-133a precursor (hsa-mir-133a-1) sequence is a product of MIR133A1, mir-133a-1 precurso, mir-133a-1, hsa-mir-133a-1 precursor, mir-133a-1 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 32 other species

    1. Aotus nancymaae miRNA
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-133a precursor
    3. Callithrix jacchus cja-mir-133a-1
    4. Camelus dromedarius (Arabian camel) microRNA 133a-1
    5. Catagonus wagneri (Chacoan peccary) microRNA 133a-1
    6. Cercocebus atys (Sooty mangabey) miRNA
    7. Chlorocebus sabaeus (African green monkey) miRNA
    8. Colobus angolensis palliatus miRNA
    9. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-133a
    10. Gorilla gorilla microRNA ggo-mir-133a precursor
    11. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-133a precursor
    12. Macaca fascicularis miRNA
    13. Macaca mulatta microRNA mml-mir-133a precursor
    14. Macaca nemestrina microRNA mne-mir-133a precursor
    15. Microcebus murinus miRNA
    16. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    17. Oryctolagus cuniculus (rabbit) microRNA 133a-1
    18. Otolemur garnettii (small-eared galago) miRNA
    19. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-133a precursor
    20. Pan troglodytes (chimpanzee) microRNA ptr-mir-133a precursor (ptr-mir-133a-1)
    21. Papio anubis (Olive baboon) miRNA
    22. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    23. Pongo abelii microRNA 133a-1
    24. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-133a precursor
    25. Prolemur simus miRNA
    26. Propithecus coquereli (Coquerel's sifaka) miRNA
    27. Rhinopithecus bieti miRNA
    28. Rhinopithecus roxellana miRNA
    29. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-133a precursor
    30. Saimiri boliviensis boliviensis miRNA
    31. Theropithecus gelada microRNA 133a-1
    32. Tupaia belangeri miRNA
    33. Vicugna pacos (alpaca) miRNA